Sequence ID | >WENV170013280 |
Genome ID | ATLU01002258 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 816 |
End posion on genome | 740 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ataaattttt |
tRNA gene sequence |
CGGGAAGTAGCTTAGCTTGGTAGAGCGCTTGGTTTGGGACCAAGAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ctaagtaatt |
Secondary structure (Cloverleaf model) | >WENV170013280 Pro TGG t ACCA ctaagtaatt C - G G - C G - C G - C A - T A - T G - C T A T T G T C C A C G A A + | | | | G T T T C G G C A G G C T + | | | T T G G A G C G T A G AGGTC C - G T - A T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |