Sequence ID | >WENV170013284 |
Genome ID | ATLU01002800 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 807 |
End posion on genome | 733 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
attattttat |
tRNA gene sequence |
AGGCCCATAGTTTAACGGCTAAAATCCGGGACTCCAAATCCCGTGCTCTAGGTTCGATTC |
Downstream region at tRNA end position |
taaaaactaa |
Secondary structure (Cloverleaf model) | >WENV170013284 Trp CCA t GCCA taaaaactaa A - T G - C G - C C - G C - G C - G A - T T T T G A T C C A C A A A | | | | | G G T T T G C T A G G C G | | | + T T C A A A T T A C TGCT C - G G - C G - C G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |