Sequence ID | >WENV170013289 |
Genome ID | ATLU01003312 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 123 |
End posion on genome | 47 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctccacttac |
tRNA gene sequence |
GGCGGTATAGCTCAGTTGGTTAGAGCAGCGGAATCATAATCCGCGTGTCCGGGGTTCAAG |
Downstream region at tRNA end position |
agaatttcta |
Secondary structure (Cloverleaf model) | >WENV170013289 Met CAT c ACCA agaatttcta G - C G - C C - G G - C G - C T - A A - T T G T G T C C C A T G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |