Sequence ID | >WENV170013290 |
Genome ID | ATLU01003351 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 257 |
End posion on genome | 182 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
taaaaagcat |
tRNA gene sequence |
GGACTTTTAGCTCAGTTGGTAGAGCAGATCCCTCTTAAGGATAAGGTCCCGGGTTCGAGC |
Downstream region at tRNA end position |
tttcaaacag |
Secondary structure (Cloverleaf model) | >WENV170013290 Lys CTT t ACCA tttcaaacag G - C G - C A - T C - G T + G T + G T - A C G T G G C C C A T G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A AGGTC G A A - T T - A C - G C - G C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |