Sequence ID | >WENV170013291 |
Genome ID | ATLU01003353 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 317 |
End posion on genome | 242 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tcaatccagt |
tRNA gene sequence |
GTCCCGTTCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGACT |
Downstream region at tRNA end position |
ttgggtcgtt |
Secondary structure (Cloverleaf model) | >WENV170013291 Glu TTC t ACCA ttgggtcgtt G + T T - A C - G C - G C - G G - C T - A T C T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |