Sequence ID | >WENV170013294 |
Genome ID | ATLU01003451 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 125 |
End posion on genome | 41 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cctgctttct |
tRNA gene sequence |
GCCCAGATGGTGGAATTGGTAGACACGCAAGACTTAAAATCTTGTTCCCTCGGGAGTCCG |
Downstream region at tRNA end position |
ttaagtttct |
Secondary structure (Cloverleaf model) | >WENV170013294 Leu TAA t ACCA ttaagtttct G - C C - G C - G C - G A - T G - C A - T C T T G G C C C A T A A G | | | | | A T G G T G C C G G G C G | | | T T G A C A C T A G G TTCCCTCGGGAGT C - G A - T A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |