Sequence ID | >WENV170013295 |
Genome ID | ATLU01003471 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 124 |
End posion on genome | 197 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ccaagacctt |
tRNA gene sequence |
TGCCCGGTCTTCTAATGGTAGGAAAGCTGGTTCTGAGCCAGAAAATTTAGGTTCGATTCC |
Downstream region at tRNA end position |
acacactctt |
Secondary structure (Cloverleaf model) | >WENV170013295 Gln CTG t TCCA acacactctt T - A G - C C - G C - G C - G G - C G G T T T A A T C C A A A C | | | | | G T T C T T T T A G G C G + | | | T T G G G A A T A A AAAT G A C - G T - A G - C G - C T G T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |