Sequence ID | >WENV170013296 |
Genome ID | ATLU01003471 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 209 |
End posion on genome | 287 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cacactcttt |
tRNA gene sequence |
TGGGGAGTGGCGCAGAATGGTATTGCACCTGACTTTGAATCAGGGAATTTTGCAGGTTCG |
Downstream region at tRNA end position |
aatcgtttca |
Secondary structure (Cloverleaf model) | >WENV170013296 Gln TTG t GCCA aatcgtttca T - A G - C G - C G - C G - C A - T G - C T A T C G T C C A A G A G | | | | | G A C G C G G C A G G C T + | | T T G T T G C G T A A GAATTTT C - G C - G T - A G - C A - T C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |