Sequence ID | >WENV170013297 |
Genome ID | ATLU01003534 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 902 |
End posion on genome | 991 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acgggtccgc |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTATACCGGGAACGGTA |
Downstream region at tRNA end position |
taaacccttg |
Secondary structure (Cloverleaf model) | >WENV170013297 Ser GCT c GCCA taaacccttg G - C G - C A - T G - C A - T C - G G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACCGGGAACGGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |