Sequence ID | >WENV170013298 |
Genome ID | ATLU01003880 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 101 |
End posion on genome | 17 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcaacgaaac |
tRNA gene sequence |
GCCTGGATGGTGGAATTGGTAGACACAGGGGACTCAAAATCCCCCGGCTTCGGCTGTGAG |
Downstream region at tRNA end position |
tataaaaaat |
Secondary structure (Cloverleaf model) | >WENV170013298 Leu CAA c ACCA tataaaaaat G + T C - G C - G T - A G - C G - C A - T T A T C T C C C A T A A G | | | | | A T G G T G G A G G G C G | | | T T G A C A C T A G A CGGCTTCGGCTGT G - C G - C G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |