Sequence ID | >WENV170013299 |
Genome ID | ATLU01003936 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 907 |
End posion on genome | 981 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gagaatttat |
tRNA gene sequence |
TCCTCCGTAGCTCAGCGGTAGAGTAGACGACTGTTAATCGTTTGGTCACTGGTTCGAATC |
Downstream region at tRNA end position |
taaaataata |
Secondary structure (Cloverleaf model) | >WENV170013299 Asn GTT t GCCA taaaataata T - A C - G C - G T + G C - G C - G G - C T A T T G A C C A G A A | | | | | G C C T C G A C T G G C G | | | + T T G G A G T T A A TGGTC G + T A - T C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |