Sequence ID | >WENV170013301 |
Genome ID | ATLU01004135 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 932 |
End posion on genome | 858 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttgtgtctat |
tRNA gene sequence |
GCCGGGGTAGCTCAGGGGTAGAGCAGGGGACTGAAAATCCCTGTGTCGGTGGTTCAAATC |
Downstream region at tRNA end position |
ttctttgaaa |
Secondary structure (Cloverleaf model) | >WENV170013301 Phe GAA t ACCA ttctttgaaa G - C C - G C - G G - C G + T G - C G - C T A T C C G C C A G A A | | + | | A G C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G + T G - C G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |