Sequence ID | >WENV170013302 |
Genome ID | ATLU01004135 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 836 |
End posion on genome | 748 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
acataaaaat |
tRNA gene sequence |
GCGCAGGTGGTGAAATGGTAGACACGCACGCTTGAGGGGCGTGTGAGCCAATAGTGCTCG |
Downstream region at tRNA end position |
tataaaaaag |
Secondary structure (Cloverleaf model) | >WENV170013302 Leu GAG t ACCA tataaaaaag G - C C - G G - C C - G A - T G - C G + T T G T C T C C C A T A A G | | | | | A G A G T G G A G G G C G | | | T T T A C A C A G G TGAGCCAATAGTGCTCGT C - G A - T C - G G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |