Sequence ID | >WENV170013306 |
Genome ID | ATLU01004208 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 946 |
End posion on genome | 873 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
TCGGGATTCGCCAAGTGGTAAGGCAAGGGACTCTGAATCCCTCACCGTAGGTTCGAATCC |
Downstream region at tRNA end position |
taaaacatat |
Secondary structure (Cloverleaf model) | >WENV170013306 Gln CTG t ACCA taaaacatat T - A C - G G - C G - C G - C A - T T - A T A T C A T C C A G A C | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A CACC A - T G - C G - C G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |