Sequence ID | >WENV170013307 |
Genome ID | ATLU01004245 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 922 |
End posion on genome | 834 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ggcaagccat |
tRNA gene sequence |
GCGGTGGTGGTGAAATTGGTAGACACGCACGCTTGAGGGGCGTGTGAGCAATTACGCTCG |
Downstream region at tRNA end position |
aatatgtttc |
Secondary structure (Cloverleaf model) | >WENV170013307 Leu GAG t ACCA aatatgtttc G - C C - G G - C G - C T T G - C G - C T G T C T C C C A T A A G | | | | | A T A G T G G A G G G C G | | | T T G A C A C T A G G TGAGCAATTACGCTCGT C - G A - T C - G G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |