Sequence ID | >WENV170013311 |
Genome ID | ATLU01004340 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 751 |
End posion on genome | 825 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ttcagcgcgc |
tRNA gene sequence |
GTCCCGTTCGTCTATCGGTTAGGACGTCAGGTTTTCAACCTGAAAAGAGGGGTTCGATTC |
Downstream region at tRNA end position |
gctgttgcca |
Secondary structure (Cloverleaf model) | >WENV170013311 Glu TTC c GCCA gctgttgcca G + T T - A C - G C - G C - G G - C T - A T T T T C C C C A C T A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C T A G AAAG T - A C - G A - T G - C G - C T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |