Sequence ID | >WENV170013316 |
Genome ID | ATLU01005300 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 8 |
End posion on genome | 84 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
nnngtatatg |
tRNA gene sequence |
GTACCCGTAGTTCAGTTGGTTAGAATGCCAGATTGTGACTCTGGAGGTCGAGGGTTCAAA |
Downstream region at tRNA end position |
ttttcttcaa |
Secondary structure (Cloverleaf model) | >WENV170013316 His GTG g CCCA ttttcttcaa G - C T - A A - T C - G C - G C - G G - C T A T T T C C C A T G A A + | | | | A T C T T G G A G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C A - T T C T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |