Sequence ID | >WENV170013321 |
Genome ID | ATLU01005551 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 477 |
End posion on genome | 552 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cacagagagt |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGTAGAGCAACTGACTTTTAATCAGTAGGTCGAAGGTTCGAAC |
Downstream region at tRNA end position |
ctttcaaaca |
Secondary structure (Cloverleaf model) | >WENV170013321 Lys TTT t ACCA ctttcaaaca G - C G + T G - C C - G C - G G - C T - A C A T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |