Sequence ID | >WENV170013322 |
Genome ID | ATLU01005576 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 201 |
End posion on genome | 128 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
caggcgtgct |
tRNA gene sequence |
GCGGGTATGGTGAAAAGGTATCACACGAGCTTCCCAAGCTCTTGTTACGGGTTCGATTCC |
Downstream region at tRNA end position |
taaaatcaat |
Secondary structure (Cloverleaf model) | >WENV170013322 Gly CCC t TCCA taaaatcaat G - C C - G G - C G - C G - C T - A A - T T T T T G C C C A A A G | | | | | G A A G T G A C G G G C G | | | | T T G T C A C T A A TGTT C T G - C A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |