Sequence ID | >WENV170013323 |
Genome ID | ATLU01005649 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 255 |
End posion on genome | 179 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgcccttgtt |
tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGTTAGAGCACTGGTTTGTGGAACCAGGGGTCCCCCGTTCGAG |
Downstream region at tRNA end position |
ccccccccca |
Secondary structure (Cloverleaf model) | >WENV170013323 His GTG t ACCA ccccccccca G + T C - G C - G G - C C - G C - G T - A C G T G G G G C A T G A A | | | | | G T C T C G C C C C G C G | | | | T T G G A G C T T A A GGGTC C - G T - A G - C G - C T - A T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |