Sequence ID | >WENV170013324 |
Genome ID | ATLU01005678 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 550 |
End posion on genome | 626 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aagcaaaacc |
tRNA gene sequence |
GGGTCTGTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
aaatcgcgta |
Secondary structure (Cloverleaf model) | >WENV170013324 Ile GAT c ACCA aaatcgcgta G - C G - C G - C T - A C - G T - A G - C T G T C C A C C A G G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |