Sequence ID | >WENV170013326 |
Genome ID | ATLU01005757 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 513 |
End posion on genome | 439 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ccaacggaat |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCATAACCTTGCCAAGGTTAGGGTCGGGCGTTCGAATC |
Downstream region at tRNA end position |
gttggaccgc |
Secondary structure (Cloverleaf model) | >WENV170013326 Gly GCC t TCCA gttggaccgc G - C C - G G - C G - C G - C C - G G - C T A T T C C G C A G A A + | | | | G G C T C G G G G C G C G | | | | T T G G A G C T A A GGGTC T - A A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |