Sequence ID | >WENV170013327 |
Genome ID | ATLU01005812 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 488 |
End posion on genome | 412 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ggattttttt |
tRNA gene sequence |
GCCACTATAGCTCAGTTGGTAGTAGCGCACCCATGGTAAGGGTGAGGTCATGGGTTCAAG |
Downstream region at tRNA end position |
tcaaacgcat |
Secondary structure (Cloverleaf model) | >WENV170013327 Thr GGT t TCCA tcaaacgcat G - C C - G C - G A - T C - G T - A A - T T G T T A C C C A T G A A | | | | | A T C T C G A T G G G C G | | | T T G T A G C T A G G AGGTC C - G A - T C - G C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |