Sequence ID | >WENV170013331 |
Genome ID | ATLU01005894 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 269 |
End posion on genome | 344 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atatatatta |
tRNA gene sequence |
GGGCCTGTAGCTCAGGGGTTAGAGCAGTCGGCTCATAACCGATTGGTCGTTGGTTCAATT |
Downstream region at tRNA end position |
tttttaacta |
Secondary structure (Cloverleaf model) | >WENV170013331 Met CAT a ACCA tttttaacta G - C G - C G - C C - G C - G T - A G - C T T T C A A C C A G G A A | | | | | A G C T C G G T T G G C G | | | | T T T G A G C T A A TGGTC G + T T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |