Sequence ID | >WENV170013332 |
Genome ID | ATLU01005991 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 263 |
End posion on genome | 188 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ggtatatcat |
tRNA gene sequence |
GCTTCCGTAGCTCATCTGGAAGAGCGCAGCCCTCCGAAGGCTGAGGTGGTAGGTTCGAGT |
Downstream region at tRNA end position |
acatatgggt |
Secondary structure (Cloverleaf model) | >WENV170013332 Arg CCG t GCCA acatatgggt G - C C - G T - A T + G C - G C - G G - C T G T T A T C C A C T A A + | | | | G T C T C G G T A G G C G | | | | T T G G A G C A A G AGGTG C - G A - T G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |