Sequence ID | >WENV170013333 |
Genome ID | ATLU01006141 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 606 |
End posion on genome | 687 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgcggaccat |
tRNA gene sequence |
GCGGGTGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGCGTGGG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170013333 Leu TAG t Gnnn nnnnnnnnnn G - C C - G G - C G - C G - C T - A G - C T G T T T C C C A T A A G + + | | | A T G G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCGAGGCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |