Sequence ID | >WENV170013334 |
Genome ID | ATLU01006237 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 292 |
End posion on genome | 367 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaagaagatg |
tRNA gene sequence |
GCGATTGTGGTGAAGTGGTTAACACACCGGCTTGTGGCGCCGGCATTCGTGGGTTCGATC |
Downstream region at tRNA end position |
aattgggcta |
Secondary structure (Cloverleaf model) | >WENV170013334 His GTG g CCCA aattgggcta G - C C - G G - C A - T T + G T - A G - C C T T T A C C C A T G A G + | | | | G G A G T G G T G G G C G | | | T T T A C A C T A A CATTC C - G C - G G - C G - C C - G T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |