Sequence ID | >WENV170013335 |
Genome ID | ATLU01006237 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 371 |
End posion on genome | 445 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgccccaaat |
tRNA gene sequence |
TGGGCTATGGCCAAGTGGTTAAGGCACCGGACTTTGACTCCGGGATCGATGGTTCGAATC |
Downstream region at tRNA end position |
taatgtgcgg |
Secondary structure (Cloverleaf model) | >WENV170013335 Gln TTG t GCCA taatgtgcgg T - A G - C G - C G - C C - G T - A A - T T A T C T A C C A T G A G | | | | | G G A C C G G A T G G C G | | | T T T A G G C T A A GATC C - G C - G G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |