Sequence ID | >WENV170013336 |
Genome ID | ATLU01006237 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 452 |
End posion on genome | 534 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gccataatgt |
tRNA gene sequence |
GCGGGTGTGGCGGAACTGGCAGACGCGCTAGACTTAGGATCTAGTTCTCCGGAGTGCAGG |
Downstream region at tRNA end position |
aactataaat |
Secondary structure (Cloverleaf model) | >WENV170013336 Leu TAG t ACCA aactataaat G - C C - G G - C G - C G - C T - A G - C T T T T G T C C A C A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C C A G G TTCTCCGGAGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |