Sequence ID | >WENV170013340 |
Genome ID | ATLU01006432 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 489 |
End posion on genome | 564 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
tacaaagtag |
tRNA gene sequence |
GCAGCCGTAGCTCAGTTGGAAGAGCGCGACCCTGCGAAGGTCGAGGCCACAGGTTCGAGC |
Downstream region at tRNA end position |
tttaagtttc |
Secondary structure (Cloverleaf model) | >WENV170013340 Arg GCG g ACCA tttaagtttc G - C C - G A - T G + T C - G C - G G - C C G T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A A G AGGCC C - G G - C A - T C - G C - G C A T A G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |