| Sequence ID | >WENV170013346 |
| Genome ID | ATLU01006786 |
| Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
| Species | |
| Start position on genome | 551 |
| End posion on genome | 476 |
| Amino Acid | Lys |
| Anticodon | CTT |
| Upstream region at tRNA start position |
ctaaaaaaat |
| tRNA gene sequence |
GGATTCTTAGCTCAGTTGGTAGAGCACTCGCCTCTTAAGCGATAGGTCCCGGGTTCGAGC |
| Downstream region at tRNA end position |
attataaaca |
| Secondary structure (Cloverleaf model) | >WENV170013346 Lys CTT
t ACCA attataaaca
G - C
G - C
A - T
T - A
T - A
C - G
T - A C G
T G G C C C A
T G A A | | | | | G
T C T C G C C G G G C
G | | | | T T
G G A G C
T A A AGGTC
C T
T - A
C - G
G - C
C - G
C A
T A
C T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |