Sequence ID | >WENV170013346 |
Genome ID | ATLU01006786 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 551 |
End posion on genome | 476 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ctaaaaaaat |
tRNA gene sequence |
GGATTCTTAGCTCAGTTGGTAGAGCACTCGCCTCTTAAGCGATAGGTCCCGGGTTCGAGC |
Downstream region at tRNA end position |
attataaaca |
Secondary structure (Cloverleaf model) | >WENV170013346 Lys CTT t ACCA attataaaca G - C G - C A - T T - A T - A C - G T - A C G T G G C C C A T G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A AGGTC C T T - A C - G G - C C - G C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |