Sequence ID | >WENV170013348 |
Genome ID | ATLU01007112 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 41 |
End posion on genome | 128 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atatatattc |
tRNA gene sequence |
GGAGAGATGCCAGAGTGGACGAATGGAACGGTCTTGAAAACCGTCGTGGGGCAACTCACC |
Downstream region at tRNA end position |
ttattgtttt |
Secondary structure (Cloverleaf model) | >WENV170013348 Ser TGA c GCCA ttattgtttt G - C G - C A - T G - C A - T G - C A - T T A T G T C C C A T G A G | | | | | G G G A C C C A G G G C G | | | T T A A T G G C G A A CGTGGGGCAACTCACC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |