Sequence ID | >WENV170013349 |
Genome ID | ATLU01007112 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 148 |
End posion on genome | 238 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tggataaact |
tRNA gene sequence |
GGAAAGGTGGCAGAGTGGTTGAATGCGCACCCCTGCTAAGGGTGTGTACCGTTTTTCGGT |
Downstream region at tRNA end position |
gttaaatttc |
Secondary structure (Cloverleaf model) | >WENV170013349 Ser GCT t GCCA gttaaatttc G - C G - C A - T A - T A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G A C G G A G G G C G | | | T T T A T G C T G A G TGTACCGTTTTTCGGTACC C - G A - T C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |