Sequence ID | >WENV170013351 |
Genome ID | ATLU01007130 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 243 |
End posion on genome | 326 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttgcgtgttt |
tRNA gene sequence |
GGGCGGGTAGCGAAGTGGTTAAACGCGGCAGACTGTAACTCTGCTCCTAACGGTTCGGCG |
Downstream region at tRNA end position |
ctcattgggc |
Secondary structure (Cloverleaf model) | >WENV170013351 Tyr GTA t ACCA ctcattgggc G - C G - C G - C C T G - C G - C G - C T A T C T G C C A T G A A | + | | | A G A G C G G G C G G C G | | | T T T A C G C T A A G TCCTAACGGTTC G - C C - G A - T G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |