Sequence ID | >WENV170013354 |
Genome ID | ATLU01007410 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 333 |
End posion on genome | 258 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aaagcaacat |
tRNA gene sequence |
GCCACTTTAGCTCAGTTGGTAGAGCACTCGCCTTGTAAGCGAATGGTCGTCGGTTCAAGT |
Downstream region at tRNA end position |
gtaaacatat |
Secondary structure (Cloverleaf model) | >WENV170013354 Thr TGT t TCCA gtaaacatat G - C C - G C - G A - T C - G T - A T - A T G T C A G C C A T G A A | | | | | A T C T C G G T C G G C G | | | | T T G G A G C T A A TGGTC C A T - A C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |