Sequence ID | >WENV170013356 |
Genome ID | ATLU01007410 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 83 |
End posion on genome | 1 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttttgtttat |
tRNA gene sequence |
GCCCAGGTGGTGGAATTGGTAGACACGCTGGTCTTAGAAACCAGTGCTTAACGCGTGGAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170013356 Leu TAG t ACCn nnnnnnnnnn G - C C - G C - G C - G A - T G - C G - C T G T T C T T C A T A A G + | | | | G T G G T G G G A A G C G | | | T T G A C A C T A G G TGCTTAACGCGT C - G T - A G - C G - C T - A C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |