Sequence ID | >WENV170013357 |
Genome ID | ATLU01007491 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 252 |
End posion on genome | 178 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gttctaatat |
tRNA gene sequence |
GCGGCCATCGTCTAGTGGTTAGGACCCATGGTTTTCATCCATGTAACCGGAGTTCGATTC |
Downstream region at tRNA end position |
aattttaagt |
Secondary structure (Cloverleaf model) | >WENV170013357 Glu TTC t ACCA aattttaagt G + T C - G G - C G - C C - G C - G A - T T T T G C C T C A T G A C | | | | | G G T C T G C G G A G C G + | | | T T T G G A C T A C TAAC C - G A - T T - A G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |