Sequence ID | >WENV170013358 |
Genome ID | ATLU01007491 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 124 |
End posion on genome | 50 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaagttatat |
tRNA gene sequence |
CGCGGAGTGGAGAAGTGGTATCTCGCCAGGCTCATAACCTGGAGGTCATTGGTTCGATTC |
Downstream region at tRNA end position |
aaaaactcaa |
Secondary structure (Cloverleaf model) | >WENV170013358 Met CAT t ACCA aaaaactcaa C A G - C C - G G - C G - C A - T G - C T T T T A A C C A G A G | | | | | G T A G A G A T T G G C G | | | | T T G T C T C T A G AGGTC C - G C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |