Sequence ID | >WENV170013362 |
Genome ID | ATLU01007760 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 209 |
End posion on genome | 133 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cgtcaatgaa |
tRNA gene sequence |
GGCCCGTTGGAGAAGCGGCTTAACTCACATGCCTTTCACGCATGCATTCACGGGTTCGAA |
Downstream region at tRNA end position |
ttaagcaaat |
Secondary structure (Cloverleaf model) | >WENV170013362 Glu TTC a ACCA ttaagcaaat G - C G + T C - G C - G C - G G - C T - A T A T T G C C C A C G A G | | | | | G G A G A G A C G G G C G | | | T T C A C T C T T A A CATTC C - G A - T T - A G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |