Sequence ID | >WENV170013367 |
Genome ID | ATLU01008173 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 219 |
End posion on genome | 144 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agagcactgc |
tRNA gene sequence |
AGGTCTATCGCCAAGCGGTAAGGCAGCGGCTTTTGATGCCGCCTATTCCCTGGTTCGAAT |
Downstream region at tRNA end position |
tattatttgg |
Secondary structure (Cloverleaf model) | >WENV170013367 Gln TTG c GCCA tattatttgg A - T G - C G - C T - A C - G T - A A - T T A T G G A C C A G A C | | | | | G C A C C G C C T G G C G | | | T T G A G G C T A A CTATTC G - C C - G G - C G - C C - G T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |