Sequence ID | >WENV170013370 |
Genome ID | ATLU01009055 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 121 |
End posion on genome | 48 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tgaaagaaaa |
tRNA gene sequence |
GGCGCCTTGGCAGAGTGGCTATGCAGCGGATTGCAAATCCGTGGACCTCGGTTCGACTCC |
Downstream region at tRNA end position |
tttctttctc |
Secondary structure (Cloverleaf model) | >WENV170013370 Cys GCA a TCCA tttctttctc G - C G - C C - G G - C C - G C - G T - A T C T G G G C C A G A G | + | | | G T G A C G C T C G G C G | | | T T G A T G C C T A GGAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |