Sequence ID | >WENV170013371 |
Genome ID | ATLU01009096 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 182 |
End posion on genome | 106 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
agcccatcgt |
tRNA gene sequence |
CGGGCTATGGCGCAGCCTGGTAGCGCGTCCGTCTGGGGGACGGAAGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
atcaaaaccg |
Secondary structure (Cloverleaf model) | >WENV170013371 Pro GGG t ACCA atcaaaaccg C - G G - C G - C G - C C - G T - A A - T T G T C G T C C A C G A G | | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A G AGGTC T - A C - G C - G G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |