Sequence ID | >WENV170013373 |
Genome ID | ATLU01009246 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 144 |
End posion on genome | 71 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tacatacaat |
tRNA gene sequence |
GGTGCCTTGGTAGAGTGGTTATACAGGGGTCTGCAAAACCTCGTACAGCGGTTCAATTCC |
Downstream region at tRNA end position |
atgacttttt |
Secondary structure (Cloverleaf model) | >WENV170013373 Cys GCA t TCCA atgacttttt G - C G - C T - A G - C C - G C - G T - A T T T T C G C C A G A G | | | | | A T G A T G A G C G G C G | | | T T G A T A C T T A GTAC G - C G + T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |