Sequence ID | >WENV170013374 |
Genome ID | ATLU01009255 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 172 |
End posion on genome | 98 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gggaatatcc |
tRNA gene sequence |
GCTCCCATCGTCTAGTGGTTAGGATGCGGCCTTCTCAAGGCTGAGACCGGAGTTCAATTC |
Downstream region at tRNA end position |
tgatactttt |
Secondary structure (Cloverleaf model) | >WENV170013374 Glu CTC c ACCA tgatactttt G + T C - G T - A C - G C - G C - G A - T T T T G C C T C A T G A C | | | | | A G T C T G C G G A G C G + | | + T T T G G A T T A G AGAC C - G G + T G - C C - G C - G T A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |