| Sequence ID | >WENV170013387 |
| Genome ID | AUZX01000981 |
| Phylum/Class | [AUZX] mine drainage metagenome; uppermost (B1A) sediment-attached strata from acid streamer/mats thriving at Los Rueldos |
| Species | |
| Start position on genome | 505 |
| End posion on genome | 413 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
ggggtcaact |
| tRNA gene sequence |
GGAGAGATGTCCGAGCGGCCGAAGGAGCACGACTGGAAATCGTGTAGGTGCCTAATAAGC |
| Downstream region at tRNA end position |
tttttccccc |
| Secondary structure (Cloverleaf model) | >WENV170013387 Ser GGA
t GCCA tttttccccc
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T C T C C C A
C G A G | | | | | G
G G C C T G A G G G C
G | | | T T
C A G G A
C G A G TAGGTGCCTAATAAGCGCCTC
C - G
A - T
C - G
G - C
A - T
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |