Sequence ID | >WENV170013913 |
Genome ID | AVFP01000001 |
Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
Species | |
Start position on genome | 31878 |
End posion on genome | 31975 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
aatccagatc |
tRNA gene sequence |
GGAAGTGGATAGGGCACTGGTGGCTCTCCCGGACTTCAAATCCGGTGTAGCGGGTTAACA |
Downstream region at tRNA end position |
tatcacgcag |
Secondary structure (Cloverleaf model) | >WENV170013913 SeC(p) TCA c GCCA tatcacgcag G - C G - C A - T A - T G - C T - A G - C G G T T A T A C C C A C A C T + | | | | G T G G G A G T G G G C G | + | | T T G C T C T T G G C TGTAGCGGGTTAACAGCCTGCTGG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |