Sequence ID | >WENV170013948 |
Genome ID | AVFP01000245 |
Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
Species | |
Start position on genome | 9082 |
End posion on genome | 9172 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agctgattcc |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGCTTAAGGAGCACGCCTGGAAAGTGTGTATAGGTTAATAGCCT |
Downstream region at tRNA end position |
atcaaaaaca |
Secondary structure (Cloverleaf model) | >WENV170013948 Ser GGA c GCCA atcaaaaaca G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A T T A G TATAGGTTAATAGCCTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |