Sequence ID | >WENV170013984 |
Genome ID | AVFP01001121 |
Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
Species | |
Start position on genome | 3356 |
End posion on genome | 3267 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cccctatttt |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGCTGAAAGCGGCACCCTGCTAAGGTGTTATACTGGCAACGGTA |
Downstream region at tRNA end position |
gaaaatgccc |
Secondary structure (Cloverleaf model) | >WENV170013984 Ser GCT t GCAA gaaaatgccc G - C G - C A - T G - C A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G | | | T T C A A G C T G A G TATACTGGCAACGGTATC G + T C - G A - T C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |