Sequence ID | >WENV170014003 |
Genome ID | AVFP01001487 |
Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
Species | |
Start position on genome | 2605 |
End posion on genome | 2694 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ttggttcctc |
tRNA gene sequence |
GGAGGGATGCCGGAGCGGTCGAACGGGGCGGTCTCGAAAACCGTTGTGGGTGCAAGCCCA |
Downstream region at tRNA end position |
ccatcaccct |
Secondary structure (Cloverleaf model) | >WENV170014003 Ser CGA c GCCA ccatcaccct G - C G - C A - T G - C G - C G - C A - T T A T C T C C C A C G A G | | | | | G G G G C C G A G G G C G | | | T T T A C G G C G A G TGTGGGTGCAAGCCCACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |