| Sequence ID | >WENV170014089 |
| Genome ID | AVFP01006633 |
| Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
| Species | |
| Start position on genome | 452 |
| End posion on genome | 538 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
agagaaaaat |
| tRNA gene sequence |
GGAGAGGTGCCAGAGTGGTAATGGAGCAGATTGCTAATCTGTCAACGCGTAAGTGTTGCC |
| Downstream region at tRNA end position |
tcgcccgctg |
| Secondary structure (Cloverleaf model) | >WENV170014089 Ser GCT
t GCCT tcgcccgctg
G - C
G - C
A - T
G - C
A - T
G - C
G + T T A
T G G C C C A
G A G | | | | | G
T G A C C C C G G G C
G | | | T T
G A T G G
T A A CAACGCGTAAGTGTTGC
G + T
C - G
A - T
G - C
A - T
T A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |